Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 1781995
End position: 1782021
Length: 27

DNA sequence
>NC_020815, from 1781995 to 1782021 (27 bp); Xanthomonas citri subsp. citri Aw12879 CGCCGGTGGCGCCGGTGACGCCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1781487-1782290	Sequence	XCAW_01583 fabG Dehydrogenase (Protein is coded in complementary strand; from 1782290 to 1781487)