Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 19421
End position: 19448
Length: 28

DNA sequence
>NC_020815, from 19421 to 19448 (28 bp); Xanthomonas citri subsp. citri Aw12879 CGATTCCCCATTCCCGATTCCCTATTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 19443-20144	Sequence	XCAW_00021 - Hypothetical Protein (Protein is coded in complementary strand; from 20144 to 19443)