Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 1942265
End position: 1942288
Length: 24

DNA sequence
>NC_020815, from 1942265 to 1942288 (24 bp); Xanthomonas citri subsp. citri Aw12879 TCGATCTCGTTCTTGATCTTGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1941692-1942474	Sequence	XCAW_01743 frdB Succinate dehydrogenase (Protein is coded in complementary strand; from 1942474 to 1941692)