Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 2215828
End position: 2215863
Length: 36

DNA sequence
>NC_020815, from 2215828 to 2215863 (36 bp); Xanthomonas citri subsp. citri Aw12879 CAGCGGCTCGGTCAGCGGCTCGGTCAGCGGCTCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2215397-2217322	Sequence	XCAW_02006 gaa glutaryl-7-ACA acylase precursor (Protein is coded in complementary strand; from 2217322 to 2215397)