Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 2234121
End position: 2234165
Length: 45

DNA sequence
>NC_020815, from 2234121 to 2234165 (45 bp); Xanthomonas citri subsp. citri Aw12879 GGCCTTCTTCGCAGGCGCCTTTTTCGCGGGTGCCTTCTTGGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2233252-2234292	Sequence	XCAW_02023 dksA DnaK suppressor protein (Protein is coded in complementary strand; from 2234292 to 2233252)