Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 2412479
End position: 2412502
Length: 24

DNA sequence
>NC_020815, from 2412479 to 2412502 (24 bp); Xanthomonas citri subsp. citri Aw12879 CCTCCACCACCACCTCCTCCTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2412470-2416399	Sequence	XCAW_02182 - Hypothetical Protein (Protein is coded in complementary strand; from 2416399 to 2412470)