Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 2423831
End position: 2423858
Length: 28

DNA sequence
>NC_020815, from 2423831 to 2423858 (28 bp); Xanthomonas citri subsp. citri Aw12879 CGATTCCCCATTCCCGAGTCCCGATTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2423829-2424899	Sequence	XCAW_02191 queA S-adenosylmethionine:tRNA-ribosyltransferase-isomerase (queuine synthetase) (Protein is coded in complementary strand; from 2424899 to 2423829)