Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 2513072
End position: 2513101
Length: 30

DNA sequence
>NC_020815, from 2513072 to 2513101 (30 bp); Xanthomonas citri subsp. citri Aw12879 TGCCGGTGCCGGTGCCGGTGCCGGTGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2512161-2513195	Sequence	XCAW_02253 gumN Hypothetical Protein (Protein is coded in complementary strand; from 2513195 to 2512161)