Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 2751167
End position: 2751194
Length: 28

DNA sequence
>NC_020815, from 2751167 to 2751194 (28 bp); Xanthomonas citri subsp. citri Aw12879 GGGAATCGGGAATCGGGAATCGGGAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2750926-2751378	Sequence	XCAW_02469 - Hypothetical Protein (Protein is coded in complementary strand; from 2751378 to 2750926)