Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 3054765
End position: 3054788
Length: 24

DNA sequence
>NC_020815, from 3054765 to 3054788 (24 bp); Xanthomonas citri subsp. citri Aw12879 GCTCGCGCGCGCGTTCGCGCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3054437-3055393	Sequence	XCAW_02729 - Hypothetical Protein (Protein is coded in complementary strand; from 3055393 to 3054437)