Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 3083712
End position: 3083741
Length: 30

DNA sequence
>NC_020815, from 3083712 to 3083741 (30 bp); Xanthomonas citri subsp. citri Aw12879 GCCACTGCCCCTGCCGCTGCCACTGCCACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3081149-3084190	Sequence	XCAW_02757 - Periplasmic ligand-binding sensor domain protein (Protein is coded in complementary strand; from 3084190 to 3081149)