Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 308746
End position: 308793
Length: 48

DNA sequence
>NC_020815, from 308746 to 308793 (48 bp); Xanthomonas citri subsp. citri Aw12879 ATGACCATGACCATGACCATGACCATGACCATGACCATGACCATGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 308288-309337	Sequence	XCAW_00242 czcD Heavy metal transporter (Protein is coded in complementary strand; from 309337 to 308288)