Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 3088601
End position: 3088627
Length: 27

DNA sequence
>NC_020815, from 3088601 to 3088627 (27 bp); Xanthomonas citri subsp. citri Aw12879 GAGGCTTTGGAGGCGTTGGATGCTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3086270-3088798	Sequence	XCAW_02760 vacB Exoribonuclease (Protein is coded in complementary strand; from 3088798 to 3086270)