Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 3140246
End position: 3140281
Length: 36

DNA sequence
>NC_020815, from 3140246 to 3140281 (36 bp); Xanthomonas citri subsp. citri Aw12879 CGCCGAAAATATTGCCGAAGATATCGCCAAAGATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3139426-3140553	Sequence	XCAW_02805 dnaJ DnaJ protein (Protein is coded in complementary strand; from 3140553 to 3139426)