Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 3175382
End position: 3175408
Length: 27

DNA sequence
>NC_020815, from 3175382 to 3175408 (27 bp); Xanthomonas citri subsp. citri Aw12879 CAGGCGATGGAGGCGATGGAGGCGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3174903-3175382	Sequence	XCAW_02851 asnB Asparagine synthase (glutamine-hydrolyzing)