Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 3342439
End position: 3342462
Length: 24

DNA sequence
>NC_020815, from 3342439 to 3342462 (24 bp); Xanthomonas citri subsp. citri Aw12879 ACCGCCCCCGCCACCGCCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3339689-3342529	Sequence	XCAW_02997 aprE Subtilisin-like serine protease (Protein is coded in complementary strand; from 3342529 to 3339689)