Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 3362636
End position: 3362663
Length: 28

DNA sequence
>NC_020815, from 3362636 to 3362663 (28 bp); Xanthomonas citri subsp. citri Aw12879 GGGAATCGGGAATCGGGAATCGGGAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3362139-3362636	Sequence	XCAW_03018 - Hypothetical Protein (Protein is coded in complementary strand; from 3362636 to 3362139)