Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 3368177
End position: 3368200
Length: 24

DNA sequence
>NC_020815, from 3368177 to 3368200 (24 bp); Xanthomonas citri subsp. citri Aw12879 CCACCACCGCCAGCACCACCACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3367861-3368268	Sequence	XCAW_03024 - Hypothetical Protein (Protein is coded in complementary strand; from 3368268 to 3367861)