Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 3395069
End position: 3395093
Length: 25

DNA sequence
>NC_020815, from 3395069 to 3395093 (25 bp); Xanthomonas citri subsp. citri Aw12879 CACCGCACCCCACGGCGCCGGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3393264-3395192	Sequence	XCAW_03042 - Alpha-L-fucosidase (Protein is coded in complementary strand; from 3395192 to 3393264)