Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 3488893
End position: 3488928
Length: 36

DNA sequence
>NC_020815, from 3488893 to 3488928 (36 bp); Xanthomonas citri subsp. citri Aw12879 TTCTTGGCGTCGGCCTTGGCGTCGGCCTTGGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3488590-3489768	Sequence	XCAW_03123 - Hypothetical Protein (Protein is coded in complementary strand; from 3489768 to 3488590)