Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 3753183
End position: 3753206
Length: 24

DNA sequence
>NC_020815, from 3753183 to 3753206 (24 bp); Xanthomonas citri subsp. citri Aw12879 CAGCGGCAGCGTCACCGGTAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3752297-3755374	Sequence	XCAW_03364 cirA Outer membrane receptor protein, mostly Fe transport