Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 3841904
End position: 3841931
Length: 28

DNA sequence
>NC_020815, from 3841904 to 3841931 (28 bp); Xanthomonas citri subsp. citri Aw12879 GGGATTGGGGATTGGGGAATGGGGATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3841483-3841941	Sequence	XCAW_03431 fcbC thioesterase (Protein is coded in complementary strand; from 3841941 to 3841483)