Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 3846077
End position: 3846111
Length: 35

DNA sequence
>NC_020815, from 3846077 to 3846111 (35 bp); Xanthomonas citri subsp. citri Aw12879 GATTCCCGATTCCCGATTGCCGATTCCCGATTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3846111-3846635	Sequence	XCAW_03436 ruvC Holliday junction resolvasome endonuclease subunit (Protein is coded in complementary strand; from 3846635 to 3846111)