Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 3974938
End position: 3974961
Length: 24

DNA sequence
>NC_020815, from 3974938 to 3974961 (24 bp); Xanthomonas citri subsp. citri Aw12879 GCCGTAGCGGTAGCCGTGGCCATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3974768-3976021	Sequence	XCAW_03548 - Hypothetical Protein (Protein is coded in complementary strand; from 3976021 to 3974768)