Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 4158192
End position: 4158221
Length: 30

DNA sequence
>NC_020815, from 4158192 to 4158221 (30 bp); Xanthomonas citri subsp. citri Aw12879 TGCAGATGCAGATGCAGATGCAGATGCAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4158052-4158402	Sequence	XCAW_03729 - Hypothetical Protein (Protein is coded in complementary strand; from 4158402 to 4158052)