Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 4254473
End position: 4254500
Length: 28

DNA sequence
>NC_020815, from 4254473 to 4254500 (28 bp); Xanthomonas citri subsp. citri Aw12879 CCCATTCCCGATTCCCCATTCCCCAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4254392-4255450	Sequence	XCAW_03809 mraW S-adenosylmethionine-dependent methyltransferase involved in cell envelope biogenesis (Protein is coded in complementary strand; from 4255450 to 4254392)