Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 4297626
End position: 4297661
Length: 36

DNA sequence
>NC_020815, from 4297626 to 4297661 (36 bp); Xanthomonas citri subsp. citri Aw12879 GGCGGTGGCGGTGGCGGTGGCGGTGGCGGTGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4297164-4297784	Sequence	XCAW_03850 - Hypothetical Protein (Protein is coded in complementary strand; from 4297784 to 4297164)