Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 4314439
End position: 4314462
Length: 24

DNA sequence
>NC_020815, from 4314439 to 4314462 (24 bp); Xanthomonas citri subsp. citri Aw12879 CCGGCACCGGTACCGGCGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4313437-4315107	Sequence	XCAW_03864 betA Choline dehydrogenase and related flavoprotein