Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 4391350
End position: 4391377
Length: 28

DNA sequence
>NC_020815, from 4391350 to 4391377 (28 bp); Xanthomonas citri subsp. citri Aw12879 CGGGAATCGGGAATCGGGAATCGGGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4391323-4392801	Sequence	XCAW_03924 mreC Rod shape-determining protein MreC (Protein is coded in complementary strand; from 4392801 to 4391323)