Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 4397416
End position: 4397450
Length: 35

DNA sequence
>NC_020815, from 4397416 to 4397450 (35 bp); Xanthomonas citri subsp. citri Aw12879 GAATGGGGAATCGGGAATCGGGAATCGGGAATGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 4395433-4397418	Sequence	XCAW_03927 acoR Transcriptional activator of acetoin