Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 4404603
End position: 4404638
Length: 36

DNA sequence
>NC_020815, from 4404603 to 4404638 (36 bp); Xanthomonas citri subsp. citri Aw12879 GTGGCAGTGGCAGTGGCAGTGGCAGTGGCAGTGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4404558-4406600	Sequence	XCAW_03933 mxaF methanol dehydrogenase heavy chain (Protein is coded in complementary strand; from 4406600 to 4404558)