Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 4507374
End position: 4507401
Length: 28

DNA sequence
>NC_020815, from 4507374 to 4507401 (28 bp); Xanthomonas citri subsp. citri Aw12879 CGGGAATCGGGAATCGGGAATCGGGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4505510-4507486	Sequence	XCAW_04021 cysN GTPases - Sulfate adenylate transferase subunit 1 (Protein is coded in complementary strand; from 4507486 to 4505510)