Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 4567916
End position: 4567939
Length: 24

DNA sequence
>NC_020815, from 4567916 to 4567939 (24 bp); Xanthomonas citri subsp. citri Aw12879 CGCCAGCGCCGGCGCCACCACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4567604-4568065	Sequence	XCAW_04069 - Hypothetical Protein (Protein is coded in complementary strand; from 4568065 to 4567604)