Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 4626031
End position: 4626065
Length: 35

DNA sequence
>NC_020815, from 4626031 to 4626065 (35 bp); Xanthomonas citri subsp. citri Aw12879 TGGGAATCGGGAATCGGGAATCGGGAATCGGGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 4625217-4626032	Sequence	XCAW_04124 fabG Dehydrogenase (Protein is coded in complementary strand; from 4626032 to 4625217)