Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 4665888
End position: 4665911
Length: 24

DNA sequence
>NC_020815, from 4665888 to 4665911 (24 bp); Xanthomonas citri subsp. citri Aw12879 CCGCCGCAGCCGCCGCCATCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4665833-4667272	Sequence	XCAW_04152 leuC 3-isopropylmalate dehydratase large subunit (Protein is coded in complementary strand; from 4667272 to 4665833)