Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 4792031
End position: 4792058
Length: 28

DNA sequence
>NC_020815, from 4792031 to 4792058 (28 bp); Xanthomonas citri subsp. citri Aw12879 ATTCCCGATTCCCGATTCCCGATTCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4790442-4794488	Sequence	XCAW_04247 purL Phosphoribosylformylglycinamidine (FGAM) synthase (Protein is coded in complementary strand; from 4794488 to 4790442)