Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 4800370
End position: 4800393
Length: 24

DNA sequence
>NC_020815, from 4800370 to 4800393 (24 bp); Xanthomonas citri subsp. citri Aw12879 CCACCACCACCGGCACCACCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4799625-4800707	Sequence	XCAW_04254 - Hypothetical Protein (Protein is coded in complementary strand; from 4800707 to 4799625)