Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 4803080
End position: 4803107
Length: 28

DNA sequence
>NC_020815, from 4803080 to 4803107 (28 bp); Xanthomonas citri subsp. citri Aw12879 GAATCGGGAATGGGGAATGGGGAATCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 4802657-4803082	Sequence	XCAW_04257 holC DNA polymerase III chi subunit