Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 4932259
End position: 4932282
Length: 24

DNA sequence
>NC_020815, from 4932259 to 4932282 (24 bp); Xanthomonas citri subsp. citri Aw12879 CAGCACCTGCACCAGCACCAGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4932215-4932910	Sequence	XCAW_04371 yaeE Permease component of an uncharacterized ABC transporter (Protein is coded in complementary strand; from 4932910 to 4932215)