Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 5010520
End position: 5010564
Length: 45

DNA sequence
>NC_020815, from 5010520 to 5010564 (45 bp); Xanthomonas citri subsp. citri Aw12879 CTTGTCGTGCTGCGCTTGGTCGTGCTGCGCTTGGTCGTGCTGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5010425-5010622	Sequence	XCAW_04449 - Hypothetical Protein (Protein is coded in complementary strand; from 5010622 to 5010425)