Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 5035204
End position: 5035239
Length: 36

DNA sequence
>NC_020815, from 5035204 to 5035239 (36 bp); Xanthomonas citri subsp. citri Aw12879 TGTCGTGCGCAGTGTCGCGCGCGGTGTCGTGCACAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5034606-5035256	Sequence	XCAW_04470 acpD Acyl carrier protein phosphodiesterase