Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 5138109
End position: 5138132
Length: 24

DNA sequence
>NC_020815, from 5138109 to 5138132 (24 bp); Xanthomonas citri subsp. citri Aw12879 CCAGAACCAGAACCAGAACCAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5137724-5139622	Sequence	XCAW_04591 rho Transcription termination factor