Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 5190044
End position: 5190071
Length: 28

DNA sequence
>NC_020815, from 5190044 to 5190071 (28 bp); Xanthomonas citri subsp. citri Aw12879 ATTCCCGATTCCCCACTCCCGATTCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5190043-5191101	Sequence	XCAW_04633 qRI7 Metal-dependent proteases with possible chaperone activity (Protein is coded in complementary strand; from 5191101 to 5190043)