Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 556959
End position: 557012
Length: 54

DNA sequence
>NC_020815, from 556959 to 557012 (54 bp); Xanthomonas citri subsp. citri Aw12879 CATCTACATCTACATCTACATCTACATCTACATCTACATCTACATCTACATCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 556055-557044	Sequence	XCAW_00466 - exonuclease (Protein is coded in complementary strand; from 557044 to 556055)