Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 848919
End position: 848946
Length: 28

DNA sequence
>NC_020815, from 848919 to 848946 (28 bp); Xanthomonas citri subsp. citri Aw12879 CCGATTCCCCATTCCCAATTCCCCATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 848946-849629	Sequence	XCAW_00728 ompR Response regulator (Protein is coded in complementary strand; from 849629 to 848946)