Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 1224886
End position: 1224909
Length: 24

DNA sequence
>NC_020895, from 1224886 to 1224909 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CAGGGCCAGGGGCAGGACCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1224137-1225516	Sequence	SHJGH_1046 - multidrug efflux transport protein (Protein is coded in complementary strand; from 1225516 to 1224137)