Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 1308149
End position: 1308172
Length: 24

DNA sequence
>NC_020895, from 1308149 to 1308172 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TGCCGCTACCGCTGCCGGTGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1308136-1308342	Sequence	SHJGH_1110 - hypothetical protein (Protein is coded in complementary strand; from 1308342 to 1308136)