Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 1691263
End position: 1691286
Length: 24

DNA sequence
>NC_020895, from 1691263 to 1691286 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCGGGCTCGGGCGCAGGCGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1691184-1691390	Sequence	SHJGH_1424 - hypothetical protein (Protein is coded in complementary strand; from 1691390 to 1691184)