Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 1705406
End position: 1705429
Length: 24

DNA sequence
>NC_020895, from 1705406 to 1705429 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGCGCCCGGGCCCGCGACGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1705366-1706592	Sequence	SHJGH_1430 - ferredoxin-dependent glutamate synthase