Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 1953883
End position: 1953906
Length: 24

DNA sequence
>NC_020895, from 1953883 to 1953906 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGTCGCCATCGCCATCGCCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1952766-1954031	Sequence	SHJGH_1632 - putative metabolite transport protein